Review



u73122 tocris  (Tocris)


Bioz Verified Symbol Tocris is a verified supplier
Bioz Manufacturer Symbol Tocris manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 96
      Buy from Supplier

    Structured Review

    Tocris u73122 tocris
    U73122 Tocris, supplied by Tocris, used in various techniques. Bioz Stars score: 96/100, based on 736 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/u73122+tocris/U+73122/pm41903111-518-0-1
    Average 96 stars, based on 736 article reviews
    u73122 tocris - by Bioz Stars, 2026-09
    96/100 stars

    Images

    Related Articles

    Recombinant:

    Article Title: PDGFRβ Cells Rapidly Relay Inflammatory Signal from the Circulatory System to Neurons via Chemokine CCL2.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies ICC: Anti-MCP1 antibody Abcam Cat# ab9669; RRID: AB_2071551 ICC: NFkB p65 Santa Cruz Cat# SC-372; RRID: AB_632037 IHC/ICC: PDGF R beta antibody R&D Systems Cat# AF1042; RRID: AB_2162633 IHC: glucose transporter GLUT-1 Millipore Cat# CBL242; RRID: AB_327046 IHC: glial fibrillary acidic protein (GFAP) Dako Cat# Z0334; RRID: AB_10013382 IHC: Iba1 Wako Cat# 019-19741; RRID: AB_839504 IHC: tdTomato SICGEN Cat# AB8181-200; RRID: AB_2722750 IHC: Donkey anti-Rabbit Alexa Fluor 488 Thermo Fisher Scientific Cat# A21206; RRID: AB_2535792 IHC: Donkey anti-Rabbit Alexa Fluor 568 Thermo Fisher Scientific Cat# A10042; RRID: AB_2534017 IHC: Donkey anti-Goat Alexa Fluor 488 Thermo Fisher Scientific Cat# A11055; RRID: AB_2534102 IHC: Donkey anti-Goat Alexa Fluor 568 Thermo Fisher Scientific Cat# A11057; RRID: AB_2534104 ISH: anti-Digoxigenin-AP Fab fragments Roche Cat# 11093274910; RRID: AB_514497 ISH: anti-Digoxigenin-POD Fab fragments Roche Cat# 11207733910; RRID: AB_514500 ISH: peroxidase-IgG fraction monoclonal mouse anti-fluorescein Jackson ImmunoResearch Cat# 200-032-037; RRID: AB_2314402 ISH: anti-DNP-488 Invitrogen Cat# A-11097; RRID: AB_2314332 ISH: tyramide signal amplification TSA plus DNP system PerkinElmer Cat# NEL747A; RRID: AB_2314317 ISH: tyramide signal amplification (TSA) plus cyanine 3 system PerkinElmer Cat# NEL744 WB: GFP Thermo Fisher Scientific Cat# A11122; RRID: AB_221569 WB: GluA1 Millipore Cat# AB1504; RRID: AB_11212863 WB: GAPDH Kangchen Biotech Cat# KC-5G4; RRID: AB_2493106 Chromium Single Cell 30 Library & Gel Bead Kit v.2 10x Genomics Cat# 120237 Chromium i7 Multiplex Kit, 96 rxns 10x Genomics Cat# 120262 Chromium Single Cell A Chip Kit 10x Genomics Cat# 120236 RNAscope Multiplex Fluorescent Reagent Kit v.2 Advanced Cell Diagnostics Cat# 323100 Bacterial and Virus Strains E. coli. .. DH5a TIANGEN Biotech Cat# CB101 Lentiviruses Genechem, Shanghai, China N/A Chemicals, Peptides, and Recombinant Proteins Lipopolysaccharides (Escherichia coli, serotype O111:B4) Sigma Cat# L2630-25MG Poly(I:C) Tocris Cat# 4287 ODN-1668 InvivoGen Cat# tlrl-1668-5 DAPI Thermo Fisher Scientific Cat# D1306; RRID:AB_2629482 Recombinant Mouse CCL2/JE/MCP-1 R&D Systems Cat# 479-JE-050 BAPTA tetracesium salt Thermo Fisher Scientific Cat# B-1212 NBQX Tocris Cat# 1044 D-APV Tocris Cat# 0106 Gabazine Tocris Cat# 1262 U73122 Tocris Cat# 1268 Fast red Roche Cat# 11496549001 (Continued on next page) Neuron 100, 1–18.e1–e8, October 10, 2018 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER Fast red Sigma Cat# F4523 Evans blue Sigma Cat# E2129-10G Critical Commercial Assays Cytokine/chemokine magnetic bead panel 96-well plate assay R&D Systems Cat# MCYTOMAG-70K Deposited Data 103 single-cell RNA-seq data This paper GEO: GSE112436 Experimental Models: Cell Lines Human brain vascular pericytes (HBVP) ScienCell Cat# 1200 Human brain vascular smooth muscle cells (HBVSMC) ScienCell Cat# 1100 Experimental Models: Organisms/Strains Mouse: C57BL/6J Shanghai Laboratory Animal Center, Chinese Academy of Sciences (Shanghai, China) N/A Mouse: Ccl2 KO; B6.129S4-Ccl2tm1Rol/J The Jackson Laboratory RRID: IMSR_JAX:004434 Mouse: Ccl2-RFPflox; B6.Cg-Ccl2tm1.1Pame/J The Jackson Laboratory RRID: IMSR_JAX:016849 Mouse: Ccr2 KO; B6.129S4-Ccr2tm1Ifc/J The Jackson Laboratory RRID: IMSR_JAX:004999 Mouse: Ai9flox; B6.Cg-Gt(ROSA)26Sortm9(CAG-tdTomato)Hze/J The Jackson Laboratory RRID: IMSR_JAX:007909 Mouse: TIE2Cre; B6.Cg-Tg(Tek-cre)12Flv/J The Jackson Laboratory RRID: IMSR_JAX:004128 Mouse: Pdgfrb-Cre Cuttler et al., 2011 N/A Oligonucleotides ISH: CCL2_Probe_1-Forward primer: CCAGCACCAGCCAACTCT This paper N/A ISH: CCL2_Probe_1-Reverse primer: GGTGTACAAAAATAATATAT This paper N/A ISH: CCL2_Probe_2-Forward primer: TCTCACTGAAGCCAGCTCTC Miller et al., 2012 N/A ISH: CCL2_Probe_2-Reverse primer: CATCACAGTCCGAGTCACAC Miller et al., 2012 N/A ISH: Vtn_Probe_1-Forward primer: TGCCGACTACATGGAGCA Allen Brain Atlas, probe: RP_040922_01_C11 N/A ISH: Vtn_Probe_1-Reverse primer: GCCATAGCAGCGTCCACT Allen Brain Atlas, probe: RP_040922_01_C11 N/A RNAscope probe: Ccl2 Advanced Cell Diagnostics Cat# 311791 RNAscope probe: Col1a1 Advanced Cell Diagnostics Cat# 319371-C2 Mouse Ccr2 shRNA sequence: TGCTAAACGTCTCTGCAAA Leuschner et al., 2011 N/A Software and Algorithms Clampfit Molecular Devices https://www.moleculardevices.com/ products/axon-patch-clamp-system/ acquisition-and-analysis-software/ pclamp-software-suite MiniAnalysis Synaptosoft http://www.synaptosoft.com/MiniAnalysis/ GraphPad Prism GraphPad Software https://www.graphpad.com/scientific- software/prism/ ImageJ NIH https://imagej.nih.gov/ij/ Fiji NIH http://fiji.sc/ Image-Pro Plus Media Cybernetics http://www.mediacy.com/imageproplus (Continued on next page) e2 Neuron 100, 1–18.e1–e8, October 10, 2018

    Article Title: Synaptic plasticity via receptor tyrosine kinase/G-protein-coupled receptor crosstalk.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies anti-phospho-p44/42 MAPK Cell Signaling Technology Cat # 9101 RRID: AB_331646 anti-p44/42 MAPK Cell Signaling Technology Cat # 9102 RRID: AB_330744 anti-b-actin Sigma-Aldrich Cat # A1978, RRID: AB_476692 anti-TrkB R and D Systems Cat # AF1494 RRID:AB_2155264 anti-TrkB Millipore Sigma Cat #07-225, RRID: AB_310445 anti-Gai3 (H-7) Santa Cruz Biotechnology Cat #sc-365422, RRID: AB_10847081 anti-mGluR5 Alomone Labs Cat # AGC-007, RRID:AB_2039991 anti-HA-Tag (C29F4) Cell Signaling Technology Cat # 3724, RRID: AB_1549585 anti-myc-Tag (71D10) Cell Signaling Technology Cat #2278, RRID: AB_490778 Alexa 546 Phalloidin Invitrogen Cat # A22283 Bacterial and virus strains AAV8-hSyn-mCherry-Cre UNC Vector Core N/A AAV8-hSyn-mCherry UNC Vector Core N/A AAV8-HA-GRK2-CT UNC Vector Core N/A AAV8-DIO-GBAi-W211A-myc UNC Vector Core N/A AAV8-DIO-GBAi-S252A-myc UNC Vector Core N/A AAV5-CaMKII-mCherry-Cre UNC Vector Core N/A AAV5-CaMKII-mCherry UNC Vector Core N/A AAV1-Syn-GCaMP8m-WPRE Addgene Cat # 162375 Chemicals, peptides, and recombinant proteins Picrotoxin Tocris Cat #1128 Tetrodotoxin (TTX) Tocris Cat # 1069 DHPG Tocris Cat # 0805 MPEP Tocris Cat # 1212 U73122 Tocris Cat # 1268 U73343 Tocris Cat # 4133 PD98059 Tocris Cat # 1213 DAMGO Tocris Cat # 1171 Baclofen Tocris Cat # 0417 YM254890 Cayman Cat # 29735 Forskolin Tocris Cat # 1099 VU-29 HelloBio Cat # HB0642 ANA-12 Tocris Cat # 4781 Recombinant human BDNF Peprotech Cat # 450-02 Recombinant human NT-3 Peprotech Cat # 450-03 Recombinant human NT-4 Peprotech Cat # 450-04 Recombinant human EGF Peprotech Cat # AF-100-15 Recombinant human IGF-I Peprotech Cat # 100-11 Recombinant human NGF Peprotech Cat # 450-01 SNAP-Surface Alexa Fluor 546 New England Biolabs Cat #S9132S Critical commercial assays Universal Mycoplasma Detection Kit ATCC Cat #30-1012K (Continued on next page) Cell Reports 43, 113595, January 23, 2024 17 ..

    Virus:

    Article Title: Synaptic plasticity via receptor tyrosine kinase/G-protein-coupled receptor crosstalk.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies anti-phospho-p44/42 MAPK Cell Signaling Technology Cat # 9101 RRID: AB_331646 anti-p44/42 MAPK Cell Signaling Technology Cat # 9102 RRID: AB_330744 anti-b-actin Sigma-Aldrich Cat # A1978, RRID: AB_476692 anti-TrkB R and D Systems Cat # AF1494 RRID:AB_2155264 anti-TrkB Millipore Sigma Cat #07-225, RRID: AB_310445 anti-Gai3 (H-7) Santa Cruz Biotechnology Cat #sc-365422, RRID: AB_10847081 anti-mGluR5 Alomone Labs Cat # AGC-007, RRID:AB_2039991 anti-HA-Tag (C29F4) Cell Signaling Technology Cat # 3724, RRID: AB_1549585 anti-myc-Tag (71D10) Cell Signaling Technology Cat #2278, RRID: AB_490778 Alexa 546 Phalloidin Invitrogen Cat # A22283 Bacterial and virus strains AAV8-hSyn-mCherry-Cre UNC Vector Core N/A AAV8-hSyn-mCherry UNC Vector Core N/A AAV8-HA-GRK2-CT UNC Vector Core N/A AAV8-DIO-GBAi-W211A-myc UNC Vector Core N/A AAV8-DIO-GBAi-S252A-myc UNC Vector Core N/A AAV5-CaMKII-mCherry-Cre UNC Vector Core N/A AAV5-CaMKII-mCherry UNC Vector Core N/A AAV1-Syn-GCaMP8m-WPRE Addgene Cat # 162375 Chemicals, peptides, and recombinant proteins Picrotoxin Tocris Cat #1128 Tetrodotoxin (TTX) Tocris Cat # 1069 DHPG Tocris Cat # 0805 MPEP Tocris Cat # 1212 U73122 Tocris Cat # 1268 U73343 Tocris Cat # 4133 PD98059 Tocris Cat # 1213 DAMGO Tocris Cat # 1171 Baclofen Tocris Cat # 0417 YM254890 Cayman Cat # 29735 Forskolin Tocris Cat # 1099 VU-29 HelloBio Cat # HB0642 ANA-12 Tocris Cat # 4781 Recombinant human BDNF Peprotech Cat # 450-02 Recombinant human NT-3 Peprotech Cat # 450-03 Recombinant human NT-4 Peprotech Cat # 450-04 Recombinant human EGF Peprotech Cat # AF-100-15 Recombinant human IGF-I Peprotech Cat # 100-11 Recombinant human NGF Peprotech Cat # 450-01 SNAP-Surface Alexa Fluor 546 New England Biolabs Cat #S9132S Critical commercial assays Universal Mycoplasma Detection Kit ATCC Cat #30-1012K (Continued on next page) Cell Reports 43, 113595, January 23, 2024 17 ..



    Similar Products

    u73122 tocris  (Tocris)
    96
    Tocris u73122 tocris
    U73122 Tocris, supplied by Tocris, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/u73122+tocris/U+73122/pm41903111-518-0-1
    Average 96 stars, based on 1 article reviews
    u73122 tocris - by Bioz Stars, 2026-09
    96/100 stars
    		  Buy from Supplier
    u73122 tocris bioscience  (Tocris)
    96
    Tocris u73122 tocris bioscience
    Figure 2. Cocaine induces c-fos and electrophysiological activation of RMTg neurons via serotonin 2C receptors (5-HT2CRs) (A) RNAscope in RMTg shows co-localization of c-fos with htr2c in individual neurons (white arrows) after i.p. cocaine. Scale bar: 100 mm in top panels, 250 mm in bottom panels. (B) i.p. cocaine greatly increases proportion of htr2c cells expressing c-fos vs. i.p. saline. (C) Almost all (95% ± 1.3% mean ± SEM, statistics calculated per subject) c-fos neurons express htr2c, consistent with htr2c being necessary for c-fos expression. (D) Individual RMTg neurons having higher c-fos optical density also have higher average htr2c density (tabulated from 1,163 htr2c + c-fos double-positive cells from 6 sections of 2 rats. **p = 0.0027, ****p < 0.0001, Dunn’s multiple comparison). (E–G) Current-clamped RMTg neurons are depolarization by bath-applied cocaine; this effect is blocked by 5-HT2CR antagonist SB242084, **p = 0.0082, unpaired two-tailed t test. (H–J) In voltage clamp, bath-applied 5-HT2CR agonist Ro60-0175 induces inward current that is blocked by SB242084 (***p = 0.0001), as well as by the PLC inhibitor <t>U73122</t> (***p = 0.0005), or by a PIP2 analog in pipette internal (***p = 0.0005, post hoc pairwise comparison Bonferroni correction for all tests in J), consistent with 5-HT2CRs effects mediated by a Gq mechanism that activates PLC to deplete cellular PIP2. (K) Representative optical fiber placement alongside expression of GRAB-5-HT (green) and FoxP1 (red). Scale bar: 1 mm. (L) Cocaine increased serotonin levels at the RMTg (measured via GRAB-5-HT fluorescence). This signal peaks 3–4 min after each infusion, much earlier than cocaine-induced RMTg firing that we previously reported (which peaks 25–30 min after infusions). Time 3 drug interaction effect, ****p < 0.0001, repeated measures two-way ANOVA. Error bars indicate mean ± SEM. Sample sizes indicated in graph legends are cell/rats per group.
    U73122 Tocris Bioscience, supplied by Tocris, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/u73122+tocris/U+73122/pm37083325-150-78-79
    Average 96 stars, based on 1 article reviews
    u73122 tocris bioscience - by Bioz Stars, 2026-09
    96/100 stars
    		  Buy from Supplier
    drug u73122 tocris bioscience  (Tocris)
    96
    Tocris drug u73122 tocris bioscience
    Figure 2. Cocaine induces c-fos and electrophysiological activation of RMTg neurons via serotonin 2C receptors (5-HT2CRs) (A) RNAscope in RMTg shows co-localization of c-fos with htr2c in individual neurons (white arrows) after i.p. cocaine. Scale bar: 100 mm in top panels, 250 mm in bottom panels. (B) i.p. cocaine greatly increases proportion of htr2c cells expressing c-fos vs. i.p. saline. (C) Almost all (95% ± 1.3% mean ± SEM, statistics calculated per subject) c-fos neurons express htr2c, consistent with htr2c being necessary for c-fos expression. (D) Individual RMTg neurons having higher c-fos optical density also have higher average htr2c density (tabulated from 1,163 htr2c + c-fos double-positive cells from 6 sections of 2 rats. **p = 0.0027, ****p < 0.0001, Dunn’s multiple comparison). (E–G) Current-clamped RMTg neurons are depolarization by bath-applied cocaine; this effect is blocked by 5-HT2CR antagonist SB242084, **p = 0.0082, unpaired two-tailed t test. (H–J) In voltage clamp, bath-applied 5-HT2CR agonist Ro60-0175 induces inward current that is blocked by SB242084 (***p = 0.0001), as well as by the PLC inhibitor <t>U73122</t> (***p = 0.0005), or by a PIP2 analog in pipette internal (***p = 0.0005, post hoc pairwise comparison Bonferroni correction for all tests in J), consistent with 5-HT2CRs effects mediated by a Gq mechanism that activates PLC to deplete cellular PIP2. (K) Representative optical fiber placement alongside expression of GRAB-5-HT (green) and FoxP1 (red). Scale bar: 1 mm. (L) Cocaine increased serotonin levels at the RMTg (measured via GRAB-5-HT fluorescence). This signal peaks 3–4 min after each infusion, much earlier than cocaine-induced RMTg firing that we previously reported (which peaks 25–30 min after infusions). Time 3 drug interaction effect, ****p < 0.0001, repeated measures two-way ANOVA. Error bars indicate mean ± SEM. Sample sizes indicated in graph legends are cell/rats per group.
    Drug U73122 Tocris Bioscience, supplied by Tocris, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/u73122+tocris/U+73122/10__7554_slash_elife__64830-230-238-240
    Average 96 stars, based on 1 article reviews
    drug u73122 tocris bioscience - by Bioz Stars, 2026-09
    96/100 stars
    		  Buy from Supplier
    drug u73122 tocris cat  (Tocris)
    96
    Tocris drug u73122 tocris cat
    Figure 2. Cocaine induces c-fos and electrophysiological activation of RMTg neurons via serotonin 2C receptors (5-HT2CRs) (A) RNAscope in RMTg shows co-localization of c-fos with htr2c in individual neurons (white arrows) after i.p. cocaine. Scale bar: 100 mm in top panels, 250 mm in bottom panels. (B) i.p. cocaine greatly increases proportion of htr2c cells expressing c-fos vs. i.p. saline. (C) Almost all (95% ± 1.3% mean ± SEM, statistics calculated per subject) c-fos neurons express htr2c, consistent with htr2c being necessary for c-fos expression. (D) Individual RMTg neurons having higher c-fos optical density also have higher average htr2c density (tabulated from 1,163 htr2c + c-fos double-positive cells from 6 sections of 2 rats. **p = 0.0027, ****p < 0.0001, Dunn’s multiple comparison). (E–G) Current-clamped RMTg neurons are depolarization by bath-applied cocaine; this effect is blocked by 5-HT2CR antagonist SB242084, **p = 0.0082, unpaired two-tailed t test. (H–J) In voltage clamp, bath-applied 5-HT2CR agonist Ro60-0175 induces inward current that is blocked by SB242084 (***p = 0.0001), as well as by the PLC inhibitor <t>U73122</t> (***p = 0.0005), or by a PIP2 analog in pipette internal (***p = 0.0005, post hoc pairwise comparison Bonferroni correction for all tests in J), consistent with 5-HT2CRs effects mediated by a Gq mechanism that activates PLC to deplete cellular PIP2. (K) Representative optical fiber placement alongside expression of GRAB-5-HT (green) and FoxP1 (red). Scale bar: 1 mm. (L) Cocaine increased serotonin levels at the RMTg (measured via GRAB-5-HT fluorescence). This signal peaks 3–4 min after each infusion, much earlier than cocaine-induced RMTg firing that we previously reported (which peaks 25–30 min after infusions). Time 3 drug interaction effect, ****p < 0.0001, repeated measures two-way ANOVA. Error bars indicate mean ± SEM. Sample sizes indicated in graph legends are cell/rats per group.
    Drug U73122 Tocris Cat, supplied by Tocris, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/u73122+tocris/U+73122/10__7554_slash_elife__52160-268-159-161
    Average 96 stars, based on 1 article reviews
    drug u73122 tocris cat - by Bioz Stars, 2026-09
    96/100 stars
    		  Buy from Supplier
    recombinant proteins u73122 tocris 1268 u73343 tocris 4133 brefeldin a1 sigma b5936 200ul bapta am sigma a1076  (Tocris)
    96
    Tocris recombinant proteins u73122 tocris 1268 u73343 tocris 4133 brefeldin a1 sigma b5936 200ul bapta am sigma a1076
    Figure 2. Cocaine induces c-fos and electrophysiological activation of RMTg neurons via serotonin 2C receptors (5-HT2CRs) (A) RNAscope in RMTg shows co-localization of c-fos with htr2c in individual neurons (white arrows) after i.p. cocaine. Scale bar: 100 mm in top panels, 250 mm in bottom panels. (B) i.p. cocaine greatly increases proportion of htr2c cells expressing c-fos vs. i.p. saline. (C) Almost all (95% ± 1.3% mean ± SEM, statistics calculated per subject) c-fos neurons express htr2c, consistent with htr2c being necessary for c-fos expression. (D) Individual RMTg neurons having higher c-fos optical density also have higher average htr2c density (tabulated from 1,163 htr2c + c-fos double-positive cells from 6 sections of 2 rats. **p = 0.0027, ****p < 0.0001, Dunn’s multiple comparison). (E–G) Current-clamped RMTg neurons are depolarization by bath-applied cocaine; this effect is blocked by 5-HT2CR antagonist SB242084, **p = 0.0082, unpaired two-tailed t test. (H–J) In voltage clamp, bath-applied 5-HT2CR agonist Ro60-0175 induces inward current that is blocked by SB242084 (***p = 0.0001), as well as by the PLC inhibitor <t>U73122</t> (***p = 0.0005), or by a PIP2 analog in pipette internal (***p = 0.0005, post hoc pairwise comparison Bonferroni correction for all tests in J), consistent with 5-HT2CRs effects mediated by a Gq mechanism that activates PLC to deplete cellular PIP2. (K) Representative optical fiber placement alongside expression of GRAB-5-HT (green) and FoxP1 (red). Scale bar: 1 mm. (L) Cocaine increased serotonin levels at the RMTg (measured via GRAB-5-HT fluorescence). This signal peaks 3–4 min after each infusion, much earlier than cocaine-induced RMTg firing that we previously reported (which peaks 25–30 min after infusions). Time 3 drug interaction effect, ****p < 0.0001, repeated measures two-way ANOVA. Error bars indicate mean ± SEM. Sample sizes indicated in graph legends are cell/rats per group.
    Recombinant Proteins U73122 Tocris 1268 U73343 Tocris 4133 Brefeldin A1 Sigma B5936 200ul Bapta Am Sigma A1076, supplied by Tocris, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/u73122+tocris/U+73122/pmc05650192-1105-102-105
    Average 96 stars, based on 1 article reviews
    recombinant proteins u73122 tocris 1268 u73343 tocris 4133 brefeldin a1 sigma b5936 200ul bapta am sigma a1076 - by Bioz Stars, 2026-09
    96/100 stars
    		  Buy from Supplier

    Image Search Results


    Figure 2. Cocaine induces c-fos and electrophysiological activation of RMTg neurons via serotonin 2C receptors (5-HT2CRs) (A) RNAscope in RMTg shows co-localization of c-fos with htr2c in individual neurons (white arrows) after i.p. cocaine. Scale bar: 100 mm in top panels, 250 mm in bottom panels. (B) i.p. cocaine greatly increases proportion of htr2c cells expressing c-fos vs. i.p. saline. (C) Almost all (95% ± 1.3% mean ± SEM, statistics calculated per subject) c-fos neurons express htr2c, consistent with htr2c being necessary for c-fos expression. (D) Individual RMTg neurons having higher c-fos optical density also have higher average htr2c density (tabulated from 1,163 htr2c + c-fos double-positive cells from 6 sections of 2 rats. **p = 0.0027, ****p < 0.0001, Dunn’s multiple comparison). (E–G) Current-clamped RMTg neurons are depolarization by bath-applied cocaine; this effect is blocked by 5-HT2CR antagonist SB242084, **p = 0.0082, unpaired two-tailed t test. (H–J) In voltage clamp, bath-applied 5-HT2CR agonist Ro60-0175 induces inward current that is blocked by SB242084 (***p = 0.0001), as well as by the PLC inhibitor U73122 (***p = 0.0005), or by a PIP2 analog in pipette internal (***p = 0.0005, post hoc pairwise comparison Bonferroni correction for all tests in J), consistent with 5-HT2CRs effects mediated by a Gq mechanism that activates PLC to deplete cellular PIP2. (K) Representative optical fiber placement alongside expression of GRAB-5-HT (green) and FoxP1 (red). Scale bar: 1 mm. (L) Cocaine increased serotonin levels at the RMTg (measured via GRAB-5-HT fluorescence). This signal peaks 3–4 min after each infusion, much earlier than cocaine-induced RMTg firing that we previously reported (which peaks 25–30 min after infusions). Time 3 drug interaction effect, ****p < 0.0001, repeated measures two-way ANOVA. Error bars indicate mean ± SEM. Sample sizes indicated in graph legends are cell/rats per group.

    Journal: Cell reports

    Article Title: Innate cocaine-seeking vulnerability arising from loss of serotonin-mediated aversive effects of cocaine in rats.

    doi: 10.1016/j.celrep.2023.112404

    Figure Lengend Snippet: Figure 2. Cocaine induces c-fos and electrophysiological activation of RMTg neurons via serotonin 2C receptors (5-HT2CRs) (A) RNAscope in RMTg shows co-localization of c-fos with htr2c in individual neurons (white arrows) after i.p. cocaine. Scale bar: 100 mm in top panels, 250 mm in bottom panels. (B) i.p. cocaine greatly increases proportion of htr2c cells expressing c-fos vs. i.p. saline. (C) Almost all (95% ± 1.3% mean ± SEM, statistics calculated per subject) c-fos neurons express htr2c, consistent with htr2c being necessary for c-fos expression. (D) Individual RMTg neurons having higher c-fos optical density also have higher average htr2c density (tabulated from 1,163 htr2c + c-fos double-positive cells from 6 sections of 2 rats. **p = 0.0027, ****p < 0.0001, Dunn’s multiple comparison). (E–G) Current-clamped RMTg neurons are depolarization by bath-applied cocaine; this effect is blocked by 5-HT2CR antagonist SB242084, **p = 0.0082, unpaired two-tailed t test. (H–J) In voltage clamp, bath-applied 5-HT2CR agonist Ro60-0175 induces inward current that is blocked by SB242084 (***p = 0.0001), as well as by the PLC inhibitor U73122 (***p = 0.0005), or by a PIP2 analog in pipette internal (***p = 0.0005, post hoc pairwise comparison Bonferroni correction for all tests in J), consistent with 5-HT2CRs effects mediated by a Gq mechanism that activates PLC to deplete cellular PIP2. (K) Representative optical fiber placement alongside expression of GRAB-5-HT (green) and FoxP1 (red). Scale bar: 1 mm. (L) Cocaine increased serotonin levels at the RMTg (measured via GRAB-5-HT fluorescence). This signal peaks 3–4 min after each infusion, much earlier than cocaine-induced RMTg firing that we previously reported (which peaks 25–30 min after infusions). Time 3 drug interaction effect, ****p < 0.0001, repeated measures two-way ANOVA. Error bars indicate mean ± SEM. Sample sizes indicated in graph legends are cell/rats per group.

    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Bacterial and virus strains AAV9-hsyn-GRAB_5HT1.0 Wan et al. Nat Neurosci 2021 Apr 5. https://doi.org/10.1038/s41593-021-00823-7 Cat# 140552-AAV9 Chemicals, peptides, and recombinant proteins TSA fluorescein Akoya Biosciences Cat# NEL741001KT TSA cyanine 3 Akoya Biosciences Cat# NEL744001KT TSA cyanine 5 Akoya Biosciences Cat# NEL745001KT SB242084 Tocris Bioscience Cat# 2901 Ro60-0175 Tocris Bioscience Cat# 1854 Tetrodotoxin citrate Tocris Bioscience cat# 1078 Serotonin HCl Tocris Bioscience cat# 3547 M084 Tocris Bioscience cat# 5807 PyR3 Tocris Bioscience cat# 3751 U73122 Tocris Bioscience cat# 1268 PI(4,5)P2 DiC8 Echelon biosciences Product #4508 VO-OHpic trihydrate Sigma-Aldrich Inc, St. Louis, MO 68178 Product #V8639 N-Methyl-D-Glucamine (NMDG) Sigma-Aldrich Inc, St. Louis, MO 68178 Product #M2004 HEPES Sigma-Aldrich Inc, St. Louis, MO 68178 Product #H3375 NaHCO3 Sigma-Aldrich Inc, St. Louis, MO 68178 Product #S5761 Dextrose Sigma-Aldrich Inc, St. Louis, MO 68178 Product #D9434 MgCl2 Sigma-Aldrich Inc, St. Louis, MO 68178 Product #M2393 (+)-Sodium L-ascorbate Sigma-Aldrich Inc, St. Louis, MO 68178 Product #11140 sodium pyruvate Sigma-Aldrich Inc, St. Louis, MO 68178 Product #P2256 NaH2PO4 Sigma-Aldrich Inc, St. Louis, MO 68178 Product #S9638 CaCl2 Sigma-Aldrich Inc, St. Louis, MO 68178 Product #C7902 NaCl Sigma-Aldrich Inc, St. Louis, MO 68178 Product #S3014 KCl Sigma-Aldrich Inc, St. Louis, MO 68178 Product #P9541 EGTA Sigma-Aldrich Inc, St. Louis, MO 68178 Product #E3889 K-gluconate Sigma-Aldrich Inc, St. Louis, MO 68178 Product #G4500 Mg2ATP Sigma-Aldrich Inc, St. Louis, MO 68178 Product #A9187 Na3GTP Sigma-Aldrich Inc, St. Louis, MO 68178 Product #G8877 Na-phosphocreatine Sigma-Aldrich Inc, St. Louis, MO 68178 Product #P7936 DMSO Sigma-Aldrich Inc, St. Louis, MO 68178 Product #D8418 Critical commercial assays HybEZ Hybridization System ACD Bio-Techne Cat# 310010 Target Retrieval Reagent ACD Bio-Techne Cat# 322000 ACD Protease III Reagent ACD Bio-Techne Cat# 322340 RNAscope Multiplex Fluorescent Detection Kit v2 ACD Bio-Techne Cat# 323110 RNAscope probe for rat neun ACD Bio-Techne Cat# 436351 RNAscope probe for rat GAD1 ACD Bio-Techne Cat# 316401 RNAscope probe for rat foxp1 ACD Bio-Techne Cat# 485221 RNAscope probe for rat htr2c ACD Bio-Techne Cat# 469321 RNAscope probe for rat c-fos ACD Bio-Techne Cat# 403591 (Continued on next page) Cell Reports 42, 112404, May 30, 2023 15

    Techniques: Activation Assay, RNAscope, Expressing, Saline, Comparison, Two Tailed Test, Transferring